Stem-loop sequence rno-mir-542

Accession MI0003528
Description Rattus norvegicus miR-542 stem-loop
Gene family MIPF0000185; mir-542
Stem-loop 
        g c    gg    uca         auacc 
ucucagac u ucgg  auca   ugucacgag     a
|||||||| | ||||  ||||   |||||||||     c
agggucug a aguc  uagu   acaguguuc     u
        g a    aa    uag         acgcg
Get sequence
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (RGSC3.4) Overlapping transcripts
X: 139996190-139996268 [-]
intergenic
Clustered miRNAs
< 10kb from rno-mir-542
rno-mir-322 X: 140000161-140000255 [-]
rno-mir-503 X: 139999870-139999940 [-]
rno-mir-351 X: 139999130-139999210 [-]
rno-mir-542 X: 139996190-139996268 [-]
rno-mir-450a X: 139994947-139995037 [-]
Database links
  • ENTREZGENE: 100314199;Mir542

Mature sequence rno-miR-542-5p

Accession MIMAT0003178
Sequence

11 -  

cucggggaucaucaugucacga

 - 32

Get sequence
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-542-3p

Accession MIMAT0003179
Sequence

49 -  

ugugacagauugauaacugaaa

 - 70

Get sequence
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).