Stem-loop sequence rno-mir-541

AccessionMI0003527 (change log)
DescriptionRattus norvegicus miR-541 stem-loop
Gene family MIPF0000213; mir-541
Literature search

5 open access papers mention rno-mir-541
(5 sentences)

Stem-loop
       a  u     aag        a    g     a uccaaga 
5' gcca aa cagag   ggauucug uguu gucac c       a
   |||| || |||||   |||||||| |||| ||||| |       u
3' cggu uu gucuc   ccuaagac acaa cggug g       u
       a  c     aua        -    g     a uaaaauu 
Get sequence
Deep sequencing
443679 reads, 981 reads per million, 480 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133892655-133892744 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-541
rno-mir-3592chr6: 133884161-133884276 [-]
rno-mir-382chr6: 133884178-133884257 [+]
rno-mir-134chr6: 133884547-133884619 [+]
rno-mir-668chr6: 133885141-133885208 [+]
rno-mir-485chr6: 133885299-133885377 [+]
rno-mir-154chr6: 133888586-133888669 [+]
rno-mir-496chr6: 133889283-133889361 [+]
rno-mir-377chr6: 133890690-133890761 [+]
rno-mir-541chr6: 133892655-133892744 [+]
rno-mir-409bchr6: 133893418-133893497 [-]
rno-mir-409achr6: 133893419-133893495 [+]
rno-mir-412chr6: 133893571-133893640 [+]
rno-mir-3578chr6: 133893672-133893788 [-]
rno-mir-369chr6: 133893693-133893771 [+]
rno-mir-410chr6: 133893997-133894072 [+]
rno-mir-3072chr6: 133898795-133898905 [+]
Database links

Mature sequence rno-miR-541-5p

Accession MIMAT0003177
Previous IDsrno-miR-541
Sequence

14 - 

aagggauucugauguuggucacacu

 - 38

Get sequence
Deep sequencing443251 reads, 480 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

Mature sequence rno-miR-541-3p

Accession MIMAT0017213
Previous IDsrno-miR-541*
Sequence

56 - 

aguggcgaacacagaauccauac

 - 78

Get sequence
Deep sequencing427 reads, 133 experiments
Evidence experimental; SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).