Stem-loop sequence rno-mir-540

AccessionMI0003524 (change log)
DescriptionRattus norvegicus miR-540 stem-loop
Gene family MIPF0000212; mir-540
Literature search

3 open access papers mention rno-mir-540
(3 sentences)

Stem-loop
      ug   c      a      ac        u    -g     
5' ccc  ggg ugggcc aggguc  ccucugac cugu  gcca 
   |||  ||| |||||| ||||||  |||||||| ||||  ||| a
3' ggg  cuc auccgg uccuag  ggagacug gaca  uggg 
      gu   -      g      cu        -    ga     
Get sequence
Deep sequencing
28933 reads, 13.5 reads per million, 348 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133706202-133706285 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-540
rno-mir-493chr6: 133699509-133699592 [+]
rno-mir-337chr6: 133705920-133706016 [+]
rno-mir-3544chr6: 133705932-133706019 [-]
rno-mir-540chr6: 133706202-133706285 [+]
rno-mir-665chr6: 133706457-133706550 [+]
rno-mir-431chr6: 133711425-133711538 [+]
rno-mir-433chr6: 133712334-133712426 [+]
rno-mir-127chr6: 133713430-133713526 [+]
rno-mir-3543-1chr6: 133715345-133715459 [-]
rno-mir-434-1chr6: 133715378-133715458 [+]
Database links

Mature sequence rno-miR-540-5p

Accession MIMAT0017211
Previous IDsrno-miR-540*
Sequence

15 - 

caagggucacccucugacucugu

 - 37

Get sequence
Deep sequencing5275 reads, 245 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-540-3p

Accession MIMAT0003174
Previous IDsrno-miR-540
Sequence

52 - 

aggucagaggucgauccugggc

 - 73

Get sequence
Deep sequencing23653 reads, 328 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).