Stem-loop sequence mmu-mir-542

Accession MI0003522
Symbol MGI:Mir542
Description Mus musculus miR-542 stem-loop
Gene family MIPF0000185; mir-542
Stem-loop
  a        g c    gg    uca         -a   c 
gg ucucagac u ucgg  auca   ugucacgag  uac a
|| |||||||| | ||||  ||||   |||||||||  |||  
cc agggucug a aguc  uagu   acaguguuc  gug c
  g        g a    aa    uag         cc   u 
Get sequence
Deep sequencing
54710 reads, 97 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38) Overlapping transcripts
chrX: 53049403-53049487 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-542
mmu-mir-322 chrX: 53054255-53054349 [-]
mmu-mir-503 chrX: 53053984-53054054 [-]
mmu-mir-351 chrX: 53053255-53053353 [-]
mmu-mir-542 chrX: 53049403-53049487 [-]
mmu-mir-450a-2 chrX: 53048299-53048367 [-]
mmu-mir-450a-1 chrX: 53048154-53048244 [-]
mmu-mir-450b chrX: 53047997-53048078 [-]
Database links

Mature sequence mmu-miR-542-5p

Accession MIMAT0003171
Sequence

14 - 

cucggggaucaucaugucacga

 - 35

Get sequence
Deep sequencing 3598 reads, 74 experiments
Evidence experimental; cloned [1,4], miRAP-cloned [3], Solexa [5-6]
Predicted targets

Mature sequence mmu-miR-542-3p

Accession MIMAT0003172
Sequence

52 - 

ugugacagauugauaacugaaa

 - 73

Get sequence
Deep sequencing 33677 reads, 82 experiments
Evidence experimental; cloned [1,4], MPSS [2], miRAP-cloned [3], Solexa [5-6]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).