|
miRBase |
|
Stem-loop sequence mmu-mir-542 |
|||||
| Accession | MI0003522 | ||||
| Symbol | MGI:Mir542 | ||||
| Description | Mus musculus miR-542 stem-loop | ||||
| Gene family | MIPF0000185; mir-542 | ||||
| Stem-loop |
a g c gg uca -a c gg ucucagac u ucgg auca ugucacgag uac a || |||||||| | |||| |||| ||||||||| ||| cc agggucug a aguc uagu acaguguuc gug c g g a aa uag cc u |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence mmu-miR-542-5p |
|
| Accession | MIMAT0003171 |
| Sequence |
14 - cucggggaucaucaugucacga - 35 |
| Deep sequencing | 3598 reads, 74 experiments |
| Evidence | experimental; cloned [1,4], miRAP-cloned [3], Solexa [5-6] |
| Predicted targets |
|
Mature sequence mmu-miR-542-3p |
|
| Accession | MIMAT0003172 |
| Sequence |
52 - ugugacagauugauaacugaaa - 73 |
| Deep sequencing | 33677 reads, 82 experiments |
| Evidence | experimental; cloned [1,4], MPSS [2], miRAP-cloned [3], Solexa [5-6] |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:16582102
"The expression profile of microRNAs in mouse embryos"
Nucleic Acids Res. 34:1765-1771(2006).
|
| 3 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
| 4 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 5 |
PMID:20215419
"MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
Mol Hum Reprod. 16:463-471(2010).
|
| 6 |
PMID:20413612
"Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"
Genes Dev. 24:992-1009(2010).
|