Stem-loop sequence mmu-mir-541

AccessionMI0003521 (change log)
Symbol MGI:Mir541
DescriptionMus musculus miR-541 stem-loop
Gene family MIPF0000213; mir-541
Literature search

11 open access papers mention mmu-mir-541
(73 sentences)

Stem-loop
       a  u     aag        a    g     ----------      
5' gcca aa cagag   ggauucug uguu gucac          acucc 
   |||| || |||||   |||||||| |||| |||||          |||| a
3' cggu uu gucuc   ccuaagac acaa cggug          ugaga 
       a  c     aua        -    g     aguaaaauuu      
Get sequence
Deep sequencing
754132 reads, 1.4e+03 reads per million, 100 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109742409-109742498 [+]
sense
OTTMUST00000113366 ; Mirg-004; intron 4
OTTMUST00000113367 ; Mirg-001; intron 4
OTTMUST00000113368 ; Mirg-005; intron 5
OTTMUST00000114051 ; Mirg-010; intron 9
OTTMUST00000114052 ; Mirg-009; intron 11
OTTMUST00000114049 ; Mirg-011; intron 13
ENSMUST00000182268 ; Mirg-004; intron 4
ENSMUST00000181543 ; Mirg-001; intron 4
ENSMUST00000183116 ; Mirg-005; intron 5
ENSMUST00000182185 ; Mirg-010; intron 9
ENSMUST00000182499 ; Mirg-009; intron 11
ENSMUST00000183144 ; Mirg-011; intron 13
Clustered miRNAs
< 10kb from mmu-mir-541
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
mmu-mir-154chr12: 109738433-109738498 [+]
mmu-mir-496achr12: 109739119-109739197 [+]
mmu-mir-377chr12: 109740510-109740577 [+]
mmu-mir-541chr12: 109742409-109742498 [+]
mmu-mir-409chr12: 109743158-109743236 [+]
mmu-mir-412chr12: 109743289-109743368 [+]
mmu-mir-369chr12: 109743418-109743496 [+]
mmu-mir-410chr12: 109743715-109743795 [+]
mmu-mir-3072chr12: 109747878-109747960 [+]
Database links

Mature sequence mmu-miR-541-5p

Accession MIMAT0003170
Previous IDsmmu-miR-541
Sequence

14 - 

aagggauucugauguuggucacacu

 - 38

Get sequence
Deep sequencing751634 reads, 100 experiments
Evidence experimental; cloned [1,3], miRAP-cloned [2], Illumina [4]
Database links
Predicted targets

Mature sequence mmu-miR-541-3p

Accession MIMAT0017209
Previous IDsmmu-miR-541*
Sequence

58 - 

uggcgaacacagaauccauacu

 - 79

Get sequence
Deep sequencing2496 reads, 60 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).