Stem-loop sequence mmu-mir-539

AccessionMI0003520 (change log)
Symbol MGI:Mir539
DescriptionMus musculus miR-539 stem-loop
Gene family MIPF0000018; mir-154
Literature search

11 open access papers mention mmu-mir-539
(18 sentences)

Stem-loop
       ug                 g    -  g cu u 
5' uacu  aggagaaauuauccuug ugug uu g  c u
   ||||  ||||||||||||||||| |||| || |  |  
3' auga  uuuucuuuaauaggaac auac aa u  g u
       gu                 -    u  g ag u 
Get sequence
Deep sequencing
3585 reads, 26.9 reads per million, 52 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109728129-109728202 [+]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-539
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
mmu-mir-487bchr12: 109727333-109727414 [+]
mmu-mir-539chr12: 109728129-109728202 [+]
mmu-mir-544chr12: 109729325-109729402 [+]
mmu-mir-382chr12: 109733771-109733846 [+]
mmu-mir-134chr12: 109734139-109734209 [+]
mmu-mir-668chr12: 109734732-109734797 [+]
mmu-mir-485chr12: 109734902-109734974 [+]
mmu-mir-453chr12: 109735619-109735700 [+]
Database links

Mature sequence mmu-miR-539-5p

Accession MIMAT0003169
Previous IDsmmu-miR-539
Sequence

8 - 

ggagaaauuauccuuggugugu

 - 29

Get sequence
Deep sequencing2962 reads, 50 experiments
Evidence experimental; MPSS [2], miRAP-cloned [3], Illumina [4-5]
Database links
Predicted targets

Mature sequence mmu-miR-539-3p

Accession MIMAT0017208
Sequence

48 - 

cauacaaggauaauuucuuuuu

 - 69

Get sequence
Deep sequencing618 reads, 44 experiments
Evidence experimental; Illumina [5]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
4
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
5
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).