Stem-loop sequence mmu-mir-543

AccessionMI0003519 (change log)
Symbol MGI:Mir543
DescriptionMus musculus miR-543 stem-loop
Gene family MIPF0000110; mir-329
Literature search

15 open access papers mention mmu-mir-543
(164 sentences)

Stem-loop
   u   u  u       u  -     --      -    uu 
5'  gcu aa gagaagu gc ccgcg  uguuuu ucgc  u
    ||| || ||||||| || |||||  |||||| ||||  a
3'  cga uu uucuuca cg ggcgc  acaaag agug  u
   a   c  u       -  u     uu      c    ua 
Get sequence
Deep sequencing
24755 reads, 150 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4].

Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr12: 109717258-109717333 [+]
sense
ENSMUST00000102286 ; Mir543-201; exon 1
Clustered miRNAs
< 10kb from mmu-mir-543
mmu-mir-379chr12: 109709060-109709125 [+]
mmu-mir-411chr12: 109710175-109710256 [+]
mmu-mir-299achr12: 109710638-109710700 [+]
mmu-mir-299bchr12: 109710645-109710693 [-]
mmu-mir-380chr12: 109711803-109711863 [+]
mmu-mir-1197chr12: 109712317-109712436 [+]
mmu-mir-323chr12: 109712508-109712593 [+]
mmu-mir-758chr12: 109712810-109712890 [+]
mmu-mir-329chr12: 109713481-109713577 [+]
mmu-mir-494chr12: 109715318-109715402 [+]
mmu-mir-679chr12: 109715577-109715650 [+]
mmu-mir-1193chr12: 109715671-109715791 [+]
mmu-mir-666chr12: 109717085-109717183 [+]
mmu-mir-543chr12: 109717258-109717333 [+]
mmu-mir-495chr12: 109718754-109718816 [+]
mmu-mir-667chr12: 109720006-109720097 [+]
mmu-mir-376cchr12: 109722718-109722803 [+]
mmu-mir-654chr12: 109723218-109723301 [+]
mmu-mir-376bchr12: 109723458-109723539 [+]
mmu-mir-376achr12: 109723781-109723848 [+]
mmu-mir-300chr12: 109724313-109724391 [+]
mmu-mir-381chr12: 109726822-109726896 [+]
Database links

Mature sequence mmu-miR-543-5p

Accession MIMAT0017207
Previous IDsmmu-miR-543*
Sequence

12 - 

aaguugcccgcguguuuuucg

 - 32

Get sequence
Deep sequencing1649 reads, 51 experiments
Evidence experimental; 454 [6], Illumina [7]
Database links
Predicted targets

Mature sequence mmu-miR-543-3p

Accession MIMAT0003168
Previous IDsmmu-miR-543
Sequence

47 - 

aaacauucgcggugcacuucuu

 - 68

Get sequence
Deep sequencing23103 reads, 82 experiments
Evidence experimental; cloned [1,4], MPSS [2], miRAP-cloned [3], Illumina [5,7]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:16582102 "The expression profile of microRNAs in mouse embryos" Mineno J, Okamoto S, Ando T, Sato M, Chono H, Izu H, Takayama M, Asada K, Mirochnitchenko O, Inouye M, Kato I Nucleic Acids Res. 34:1765-1771(2006).
3
PMID:16973894 "Mouse microRNA profiles determined with a new and sensitive cloning method" Takada S, Berezikov E, Yamashita Y, Lagos-Quintana M, Kloosterman WP, Enomoto M, Hatanaka H, Fujiwara S, Watanabe H, Soda M, Choi YL, Plasterk RH, Cuppen E, Mano H Nucleic Acids Res. 34:e115(2006).
4
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
5
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
6
PMID:20668074 "Identification and analysis of expression of novel microRNAs of murine gammaherpesvirus 68" Zhu JY, Strehle M, Frohn A, Kremmer E, Hofig KP, Meister G, Adler H J Virol. 84:10266-10275(2010).
7
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).