Stem-loop sequence hsa-mir-545

Accession MI0003516
Symbol HGNC:MIR545
Description Homo sapiens miR-545 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop 
cccag    ------g   a         - u            a  a     auaaa 
     ccug       cac uuaguaggc c caguaaauguuu uu gauga     u
     ||||       ||| ||||||||| | |||||||||||| || |||||     g
     ggac       gug aaucguccg g guuauuuacaaa ga cuacu     a
-----    accucga   a         u u            c  -     cagua
Get sequence
Deep sequencing
16 reads, 8 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chrX: 73506939-73507044 [-]
sense
OTTHUMT00000057255 ; NCRNA00182-001; intron 1
OTTHUMT00000057256 ; NCRNA00182-002; intron 1
OTTHUMT00000057257 ; NCRNA00182-003; intron 1
OTTHUMT00000057258 ; NCRNA00182-004; intron 1
OTTHUMT00000057256 ; NCRNA00182-002; intron 1
OTTHUMT00000057255 ; NCRNA00182-001; intron 1
OTTHUMT00000057257 ; NCRNA00182-003; intron 1
OTTHUMT00000057258 ; NCRNA00182-004; intron 1
OTTHUMT00000057256 ; FTX-002; intron 1
OTTHUMT00000057255 ; FTX-001; intron 1
OTTHUMT00000057257 ; FTX-003; intron 1
OTTHUMT00000057258 ; FTX-004; intron 1
ENST00000429124 ; FTX-001; intron 1
ENST00000430772 ; FTX-002; intron 1
ENST00000418855 ; FTX-003; intron 1
ENST00000455395 ; FTX-004; intron 1
ENST00000430772 ; FTX-002; intron 1
ENST00000429124 ; FTX-001; intron 1
ENST00000418855 ; FTX-003; intron 1
ENST00000455395 ; FTX-004; intron 1
ENST00000430772 ; FTX-002; intron 1
ENST00000429124 ; FTX-001; intron 1
ENST00000418855 ; FTX-003; intron 1
ENST00000455395 ; FTX-004; intron 1
Clustered miRNAs
< 10kb from hsa-mir-545
hsa-mir-374a chrX: 73507121-73507192 [-]
hsa-mir-545 chrX: 73506939-73507044 [-]
Database links

Mature sequence hsa-miR-545-5p

Accession MIMAT0004785
Previous IDs hsa-miR-545*
Sequence

25 -  

ucaguaaauguuuauuagauga

 - 46

Get sequence
Deep sequencing 13 reads, 8 experiments
Evidence experimental; cloned [2]
Predicted targets

Mature sequence hsa-miR-545-3p

Accession MIMAT0003165
Previous IDs hsa-miR-545
Sequence

63 -  

ucagcaaacauuuauugugugc

 - 84

Get sequence
Deep sequencing 3 reads, 3 experiments
Evidence experimental; cloned [1-2]
Validated targets
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).