Stem-loop sequence hsa-mir-544a

AccessionMI0003515 (change log)
Previous IDshsa-mir-544
Symbol HGNC:MIR544A
DescriptionHomo sapiens miR-544a stem-loop
Gene family MIPF0000436; mir-544
Literature search

15 open access papers mention hsa-mir-544a
(115 sentences)

Stem-loop
   auuuu      cua    u           -     u   -ga  c 
5'      caucac   ggga cuuguuaaaaa gcaga ucu   uu a
        ||||||   |||| ||||||||||| ||||| |||   ||  
3'      guagug   cucu gaacgauuuuu cgucu aga   ag g
   uaauc      -aa    u           a     u   acc  g 
Get sequence
Deep sequencing
288 reads, 2.56 reads per million, 78 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101048658-101048748 [+]
antisense
OTTHUMT00000414335 ; BEGAIN-006; intron 1
ENST00000554140 ; BEGAIN-006; intron 1
Clustered miRNAs
< 10kb from hsa-mir-544a
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
hsa-mir-1185-2chr14: 101044198-101044283 [+]
hsa-mir-381chr14: 101045920-101045994 [+]
hsa-mir-487bchr14: 101046455-101046538 [+]
hsa-mir-539chr14: 101047321-101047398 [+]
hsa-mir-889chr14: 101047901-101047979 [+]
hsa-mir-544achr14: 101048658-101048748 [+]
hsa-mir-655chr14: 101049550-101049646 [+]
hsa-mir-487achr14: 101052446-101052525 [+]
hsa-mir-382chr14: 101054306-101054381 [+]
hsa-mir-134chr14: 101054687-101054759 [+]
hsa-mir-668chr14: 101055258-101055323 [+]
hsa-mir-485chr14: 101055419-101055491 [+]
hsa-mir-323bchr14: 101056219-101056300 [+]
Database links

Mature sequence hsa-miR-544a

Accession MIMAT0003164
Previous IDshsa-miR-544
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Deep sequencing76 reads, 43 experiments
Evidence experimental; cloned [1-2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).