|
miRBase |
|
Mature sequence hsa-miR-539-5p |
|
| Accession | MIMAT0003163 |
| Previous IDs | hsa-miR-539 |
| Sequence |
9 - ggagaaauuauccuuggugugu - 30 |
| Deep sequencing | 3 reads, 1 experiments |
| Evidence | experimental; cloned [1,3], miRAP-cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-539-3p |
|
| Accession | MIMAT0022705 |
| Sequence |
49 - aucauacaaggacaauuucuuu - 70 |
| Deep sequencing | 1913 reads, 6 experiments |
| Evidence | not experimental |
| Predicted targets |
|
References |
|
| 1 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 2 |
PMID:16973894
"Mouse microRNA profiles determined with a new and sensitive cloning method"
Nucleic Acids Res. 34:e115(2006).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|