Stem-loop sequence hsa-mir-455

AccessionMI0003513
Symbol HGNC:MIR455
DescriptionHomo sapiens miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
   ----ucccu   -g     -----          u      a   c   gaa 
5'          ggc  ugagg     guaugugccu uggacu cau gug   g
            |||  |||||     |||||||||| |||||| ||| |||    
3'          ccg  acucc     cauauacggg accuga gua cac   c
   cuacuguau   ga     guuca          u      c   c   gac 
Get sequence
Deep sequencing
7897 reads, 3.06e+03 reads per million, 72 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mir-455 precursor was predicted computationally and a 5' mature product verified in human by Northern blot [1]. The precise sequence termini of the mature forms were derived by cloning from human and rat samples [2].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr9: 114209434-114209529 [+]
antisense
OTTHUMT00000053637 ; KIAA0368-001; intron 2
OTTHUMT00000467788 ; KIAA0368-005; intron 2
OTTHUMT00000467789 ; KIAA0368-004; intron 3
ENST00000338205 ; KIAA0368-001; intron 2
ENST00000602447 ; KIAA0368-005; intron 2
ENST00000602978 ; KIAA0368-004; intron 3
ENST00000259335 ; KIAA0368-201; intron 4
Database links

Mature sequence hsa-miR-455-5p

Accession MIMAT0003150
Previous IDshsa-miR-455
Sequence

16 - 

uaugugccuuuggacuacaucg

 - 37

Get sequence
Deep sequencing565 reads, 55 experiments
Evidence experimental; Northern [1], cloned [2-3]
Predicted targets

Mature sequence hsa-miR-455-3p

Accession MIMAT0004784
Sequence

54 - 

gcaguccaugggcauauacac

 - 74

Get sequence
Deep sequencing3102 reads, 62 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).