Stem-loop sequence hsa-mir-455

Accession MI0003513
Symbol HGNC:MIR455
Description Homo sapiens miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop 
----ucccu   -g     -----          u      a   c   gaa 
         ggc  ugagg     guaugugccu uggacu cau gug   g
         |||  |||||     |||||||||| |||||| ||| |||    
         ccg  acucc     cauauacggg accuga gua cac   c
cuacuguau   ga     guuca          u      c   c   gac
Get sequence
Deep sequencing
3192 reads, 42 experiments
Comments

The mir-455 precursor was predicted computationally and a 5' mature product verified in human by Northern blot [1]. The precise sequence termini of the mature forms were derived by cloning from human and rat samples [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr9: 116971714-116971809 [+]
sense
OTTHUMT00000053766 ; COL27A1-004; intron 5
OTTHUMT00000053766 ; COL27A1-004; intron 5
OTTHUMT00000053766 ; COL27A1-004; intron 5
OTTHUMT00000053764 ; COL27A1-002; intron 7
OTTHUMT00000053764 ; COL27A1-002; intron 7
OTTHUMT00000053764 ; COL27A1-002; intron 7
OTTHUMT00000053763 ; COL27A1-001; intron 10
OTTHUMT00000053763 ; COL27A1-001; intron 10
OTTHUMT00000053763 ; COL27A1-001; intron 10
ENST00000451716 ; COL27A1-004; intron 5
ENST00000451716 ; COL27A1-004; intron 5
ENST00000451716 ; COL27A1-004; intron 5
ENST00000374106 ; COL27A1-202; intron 6
ENST00000374106 ; COL27A1-202; intron 6
ENST00000494090 ; COL27A1-002; intron 7
ENST00000494090 ; COL27A1-002; intron 7
ENST00000494090 ; COL27A1-002; intron 7
ENST00000356083 ; COL27A1-001; intron 10
ENST00000357257 ; COL27A1-201; intron 10
ENST00000356083 ; COL27A1-001; intron 10
ENST00000357257 ; COL27A1-201; intron 10
ENST00000356083 ; COL27A1-001; intron 10
Database links

Mature sequence hsa-miR-455-5p

Accession MIMAT0003150
Previous IDs hsa-miR-455
Sequence

16 -  

uaugugccuuuggacuacaucg

 - 37

Get sequence
Deep sequencing 722 reads, 28 experiments
Evidence experimental; Northern [1], cloned [2-3]
Predicted targets

Mature sequence hsa-miR-455-3p

Accession MIMAT0004784
Sequence

54 -  

gcaguccaugggcauauacac

 - 74

Get sequence
Deep sequencing 2470 reads, 29 experiments
Evidence experimental; cloned [2-3]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).