Stem-loop sequence ppt-MIR537a

Accession MI0003508
Description Physcomitrella patens miR537a stem-loop
Gene family MIPF0000207; MIR537
Stem-loop 
       -      a   a              g   c ag     a  -au     u   gccauggaaacagauaagagcucaugucuggguu 
guugucg ucauau ugg cuguagaaacaccu aag g  ugagg cc   ccgau cua                                  c
||||||| |||||| ||| |||||||||||||| ||| |  ||||| ||   ||||| |||                                  c
cgauagu aguaua auc gacaucuuugugga uuc c  acuuc gg   ggcua gau                                  u
       u      c   g              g   u aa     -  auu     c   agaguacgcguuuggaguuuucguagugucuuug
Get sequence
Deep sequencing
2703 reads, 3 experiments
Genome context
Coordinates (JGI1.1) Overlapping transcripts
scaffold_52: 1225399-1225588 [+]
intergenic

Mature sequence ppt-miR537a

Accession MIMAT0003145
Sequence

155 -  

uugagguguuucuacaggcua

 - 175

Get sequence
Deep sequencing 2312 reads, 3 experiments
Evidence experimental; cloned [1-2], 454 [3]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).