Stem-loop sequence ppt-MIR156a

AccessionMI0003506
DescriptionPhyscomitrella patens miR156a stem-loop
Gene family MIPF0000008; MIR156
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-156_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

MicroRNA (miRNA) precursor mir-156 is a family of plant non-coding RNA. This microRNA has now been predicted or experimentally confirmed in a range of plant species (MIPF0000008). Animal miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In plants the precursor sequences may be longer, and the carpel factory (caf) enzyme appears to be involved in processing. In this case the mature sequence comes from the 5' arm of the precursor, and both Arabidopsis thaliana and rice genomes contain a number of related miRNA precursors which give rise to almost identical mature sequences. The extents of the hairpin precursors are not generally known and are estimated based on hairpin prediction. The products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
       gu      u u  ga       -               gc  a   u    aug 
5' ggcg  ggagga g gg  gugacag aagagagugagcaca  ug gca guac   a
   ||||  |||||| | ||  ||||||| |||||||||||||||  || ||| ||||    
3' ucgc  uuuccu c cc  cgcuguc uucucucacucgugu  ac cgu caug   g
       ag      - u  -a       c               gu  c   u    aag 
Get sequence
Deep sequencing
1792 reads, 1.2e+04 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI1.1) Overlapping transcripts
scaffold_12: 1858517-1858631 [-]
intergenic

Mature sequence ppt-miR156a

Accession MIMAT0003143
Sequence

21 - 

ugacagaagagagugagcac

 - 40

Get sequence
Deep sequencing1555 reads, 3 experiments
Evidence experimental; cloned [1-2], 454 [3]
Validated targets

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).