Stem-loop sequence ppt-MIR535a

AccessionMI0003502 (change log)
DescriptionPhyscomitrella patens miR535a stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
        u   acg        ---ccua          ag    a              uu    u  a 
5' ggagg gaa   guggagaa       ggugacaacg  agag gcacgcuggaaugc  uuca gc a
   ||||| |||   ||||||||       ||||||||||  |||| ||||||||||||||  |||| || u
3' ucucc cuu   uaccucuu       ccgcuguugc  ucuc cgugcgaucuugug  aggu cg a
        u   cag        cuacaaa          ca    c              -u    u  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr08: 9104145-9104279 [+]
intergenic
Database links

Mature sequence ppt-miR535a

Accession MIMAT0003139
Sequence

27 - 

ugacaacgagagagagcacgc

 - 47

Get sequence
Evidence experimental; cloned [1-2], 454 [3]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17359535 "Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution" Fattash I, Voss B, Reski R, Hess WR, Frank W BMC Plant Biol. 7:13(2007).
3
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).