Stem-loop sequence ppt-MIR319c

AccessionMI0003498 (change log)
DescriptionPhyscomitrella patens miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

3 open access papers mention ppt-MIR319c
(15 sentences)

Stem-loop
        u  cu   u                      u  u      ua     -    a u   g   ac   a  uuc   c      c  uu 
5' uaacc ca  ggc gugggagcuuccuucgguucaa ag ggcuga  ugagg uugc c gcu ccg  uca ac   cgg uucccu uc  a
   ||||| ||  ||| |||||||||||||||||||||| || ||||||  ||||| |||| | ||| |||  ||| ||   ||| |||||| ||  g
3' auugg gu  cug uacccucgagggaagucagguu uc ucgacu  acuuc ggcg g cga ggc  agu ug   gcc aaggga gg  a
        u  uu   -                      c  u      ca     u    a u   g   gu   c  uaa   u      c  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr09: 7950311-7950499 [+]
intergenic
Database links

Mature sequence ppt-miR319c

Accession MIMAT0003135
Sequence

154 - 

cuuggacugaagggagcuccc

 - 174

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).