Stem-loop sequence ppt-MIR319b

AccessionMI0003497 (change log)
DescriptionPhyscomitrella patens miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

3 open access papers mention ppt-MIR319b
(32 sentences)

Stem-loop
   --                  u  ca      g c  a     uacc   g   ac   a    c   c              
5'   gagcucuuuucaguccag ag  gcuaau u ga gguug    gcu ccg  uca acuu cgg uuccauaucacga 
     |||||||||||||||||| ||  |||||| | || |||||    ||| |||  ||| |||| ||| |||||||||||| c
3'   cucgagggaagucagguu uc  cgauug a cu cuagc    cga ggc  agu ugga gcc aagguauagugcg 
   uc                  c  ua      g c  -     uagu   g   cu   c    a   u              
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v3.0) Overlapping transcripts
Chr19: 4255957-4256116 [-]
intergenic
Database links

Mature sequence ppt-miR319b

Accession MIMAT0003134
Sequence

140 - 

cuuggacugaagggagcucc

 - 159

Get sequence
Evidence experimental; cloned [1], 454 [2]

References

1
PMID:16146523 "Cloning and characterization of micro-RNAs from moss" Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC Plant J. 43:837-848(2005).
2
PMID:17601824 "Common functions for diverse small RNAs of land plants" Axtell MJ, Snyder JA, Bartel DP Plant Cell. 19:1750-1769(2007).