Stem-loop sequence mmu-mir-486a

AccessionMI0003493
Previous IDsmmu-mir-486
Symbol MGI:Mir486
DescriptionMus musculus miR-486a stem-loop
Gene family MIPF0000220; mir-486
Stem-loop
   ca  --cag     auc  g   u      g g                       guccuuca   u 
5'   gc     cucug   uc ccc cccuga g guccuguacugagcugccccgag        cug g
     ||     |||||   || ||| |||||| | |||||||||||||||||||||||        |||  
3'   cg     ggggc   ag ggg gggacu c uaggacaugacucgacggggcuc        gac c
   ac  aacaa     aac  a   u      g g                       --------   u 
Get sequence
Deep sequencing
132890 reads, 353 reads per million, 107 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr8: 23142555-23142682 [+]
sense
OTTMUST00000094968 ; Ank1-017; intron 2
OTTMUST00000065245 ; Ank1-013; intron 3
OTTMUST00000065246 ; Ank1-014; intron 3
OTTMUST00000065244 ; Ank1-012; intron 4
OTTMUST00000065243 ; Ank1-011; intron 41
OTTMUST00000065237 ; Ank1-005; intron 42
OTTMUST00000065238 ; Ank1-006; intron 42
OTTMUST00000065239 ; Ank1-007; intron 42
OTTMUST00000065240 ; Ank1-008; intron 42
OTTMUST00000065236 ; Ank1-004; intron 43
OTTMUST00000065234 ; Ank1-001; intron 43
OTTMUST00000065247 ; Ank1-003; intron 44
OTTMUST00000065235 ; Ank1-002; intron 44
OTTMUST00000094966 ; Ank1-015; intron 44
OTTMUST00000094967 ; Ank1-016; intron 44
ENSMUST00000174435 ; Ank1-017; intron 2
ENSMUST00000033947 ; Ank1-013; intron 3
ENSMUST00000130311 ; Ank1-014; intron 3
ENSMUST00000121075 ; Ank1-012; intron 4
ENSMUST00000141784 ; Ank1-011; intron 41
ENSMUST00000110688 ; Ank1-005; intron 42
ENSMUST00000117270 ; Ank1-006; intron 42
ENSMUST00000117662 ; Ank1-007; intron 42
ENSMUST00000117296 ; Ank1-008; intron 42
ENSMUST00000121802 ; Ank1-004; intron 43
ENSMUST00000118733 ; Ank1-001; intron 43
ENSMUST00000123418 ; Ank1-003; intron 44
ENSMUST00000084038 ; Ank1-002; intron 44
ENSMUST00000173248 ; Ank1-015; intron 44
ENSMUST00000173573 ; Ank1-016; intron 44
antisense
OTTMUST00000065233 ; AC126445.2-001; intron 3
ENSMUST00000141930 ; Gm15816-001; intron 3
Clustered miRNAs
< 10kb from mmu-mir-486a
mmu-mir-486achr8: 23142555-23142682 [+]
mmu-mir-486bchr8: 23142573-23142662 [-]
Database links

Mature sequence mmu-miR-486a-5p

Accession MIMAT0003130
Previous IDsmmu-miR-486-5p
Sequence

33 - 

uccuguacugagcugccccgag

 - 54

Get sequence
Deep sequencing17207 reads, 87 experiments
Evidence experimental; cloned [1], Illumina [2-3]
Validated targets
Predicted targets

Mature sequence mmu-miR-486a-3p

Accession MIMAT0017206
Previous IDsmmu-miR-486-3p
Sequence

75 - 

cggggcagcucaguacaggau

 - 95

Get sequence
Deep sequencing3230 reads, 76 experiments
Evidence experimental; Illumina [3]
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
3
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).