Stem-loop sequence mmu-mir-484

AccessionMI0003491 (change log)
Symbol MGI:Mir484
DescriptionMus musculus miR-484 stem-loop
Gene family MIPF0000219; mir-484
Literature search

17 open access papers mention mmu-mir-484
(44 sentences)

Stem-loop
   cu    ag  u        ucccgauaaaccuca 
5'   cguc  gc cagucccc               a
     ||||  || ||||||||                
3'   gcgg  cg gucggggg               a
   au    --  -        auccauucugggaua 
Get sequence
Deep sequencing
76773 reads, 327 reads per million, 105 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 14159626-14159692 [+]
intergenic
Database links

Mature sequence mmu-miR-484

Accession MIMAT0003127
Sequence

5 - 

ucaggcucaguccccucccgau

 - 26

Get sequence
Deep sequencing76671 reads, 105 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
2
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).