Stem-loop sequence rno-mir-133b

AccessionMI0003490 (change log)
DescriptionRattus norvegicus miR-133b stem-loop
Gene family MIPF0000029; mir-133
Literature search

85 open access papers mention rno-mir-133b
(328 sentences)

Stem-loop
   -------       c        ca  c  a      u  g      
5'        cccugcu uggcuggu  aa gg accaag cc ucuuc 
          ||||||| ||||||||  || || |||||| || |||| c
3'        gggacga aucgacca  uu cc ugguuu gg agagu 
   aacgguc       c        ac  c  c      -  -      
Get sequence
Deep sequencing
32127072 reads, 1.97e+04 reads per million, 492 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr9: 26795649-26795732 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-133b
rno-mir-206chr9: 26791764-26791847 [+]
rno-mir-133bchr9: 26795649-26795732 [+]
Database links

Mature sequence rno-miR-133b-5p

Accession MIMAT0017205
Previous IDsrno-miR-133b*
Sequence

11 - 

gcuggucaaacggaaccaagu

 - 31

Get sequence
Deep sequencing488 reads, 55 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-133b-3p

Accession MIMAT0003126
Previous IDsrno-miR-133b
Sequence

48 - 

uuugguccccuucaaccagcua

 - 69

Get sequence
Deep sequencing32126579 reads, 491 experiments
Evidence experimental; cloned [1-2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).