Stem-loop sequence rno-mir-1

AccessionMI0003489 (change log)
DescriptionRattus norvegicus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Literature search

126 open access papers mention rno-mir-1
(898 sentences)

Stem-loop
                c                ac     ugaaca 
5' ugccuacucagag acauacuucuuuaugu  ccaua      u
   ||||||||||||| ||||||||||||||||  |||||       
3' auggauggguuuu ugugugaagaaaugua  gguau      a
                a                -a     cguaag 
Get sequence
Deep sequencing
527149 reads, 343 reads per million, 403 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr18: 2054933-2055019 [-]
antisense
ENSRNOT00000053646 ; Mir3571-201; exon 1
ENSRNOT00000018025 ; Mib1-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-1
rno-mir-1chr18: 2054933-2055019 [-]
rno-mir-3571chr18: 2054922-2055032 [+]
rno-mir-133achr18: 2052478-2052564 [-]
rno-mir-133cchr18: 2052459-2052576 [+]
Database links

Mature sequence rno-miR-1-5p

Accession MIMAT0003162
Previous IDsrno-miR-1*
Sequence

13 - 

gcacauacuucuuuauguaccc

 - 34

Get sequence
Deep sequencing14 reads, 11 experiments
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-1-3p

Accession MIMAT0003125
Previous IDsrno-miR-1
Sequence

54 - 

uggaauguaaagaaguguguau

 - 75

Get sequence
Deep sequencing527035 reads, 404 experiments
Evidence experimental; cloned [2], SOLiD [3]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).