Stem-loop sequence rno-mir-1

AccessionMI0003489
DescriptionRattus norvegicus miR-1 stem-loop
Gene family MIPF0000038; mir-1
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-1_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-1 microRNA precursor is a small micro RNA that regulates its target protein's expression in the cell. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide products. In this case the mature sequence comes from the 3' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. In humans there are two distinct microRNAs that share an identical mature sequence, these are called miR-1-1 and miR-1-2. These micro RNAs have pivotal roles in development and physiology of muscle tissues including the heart. MiR-1 is known to be involved in important role in heart diseases such as hypertrophy, myocardial infarction, and arrhythmias. Studies have shown that MiR-1 is an important regulator of heart adaption after ischemia or ischaemic stress and it is upregulated in the remote myocardium of patients with myocardial infarction. Also MiR-1 is downregulated in myocardial infarcted tissue compared to healthy heart tissue. Plasma levels of MiR-1 can be used as a sensitive biomarker for myocardial infarction.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
                c                ac     ugaaca 
5' ugccuacucagag acauacuucuuuaugu  ccaua      u
   ||||||||||||| ||||||||||||||||  |||||       
3' auggauggguuuu ugugugaagaaaugua  gguau      a
                a                -a     cguaag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The ends of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (Rnor_5.0) Overlapping transcripts
chr18: 2087912-2087998 [-]
antisense
ENSRNOT00000053646 ; Mir3571-201; exon 1
ENSRNOT00000018025 ; Mib1-201; intron 12
Clustered miRNAs
< 10kb from rno-mir-1
rno-mir-1chr18: 2087912-2087998 [-]
rno-mir-3571chr18: 2087901-2088011 [+]
rno-mir-133achr18: 2085457-2085543 [-]
rno-mir-133cchr18: 2085438-2085555 [+]
Database links

Mature sequence rno-miR-1-5p

Accession MIMAT0003162
Previous IDsrno-miR-1*
Sequence

13 - 

gcacauacuucuuuauguaccc

 - 34

Get sequence
Evidence experimental; SOLiD [3]
Predicted targets

Mature sequence rno-miR-1-3p

Accession MIMAT0003125
Previous IDsrno-miR-1
Sequence

54 - 

uggaauguaaagaaguguguau

 - 75

Get sequence
Evidence experimental; cloned [2], SOLiD [3]
Validated targets
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).