Stem-loop sequence rno-mir-370

AccessionMI0003486 (change log)
DescriptionRattus norvegicus miR-370 stem-loop
Gene family MIPF0000167; mir-370
Literature search

14 open access papers mention rno-mir-370
(28 sentences)

Stem-loop
          g         ca gu   u    u   a  g 
5' agacaga agaccaggu  c  cuc gcag uac ca c
   ||||||| |||||||||  |  ||| |||| ||| || u
3' ucugucu uuuggucca  g  ggg cguc gug gu c
          g         ag ug   u    c   a  a 
Get sequence
Deep sequencing
8735 reads, 3.17 reads per million, 252 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr6: 133739916-133739994 [+]
intergenic
Clustered miRNAs
< 10kb from rno-mir-370
rno-mir-341chr6: 133733240-133733335 [+]
rno-mir-1188chr6: 133733578-133733659 [+]
rno-mir-370chr6: 133739916-133739994 [+]
Database links

Mature sequence rno-miR-370-5p

Accession MIMAT0017202
Previous IDsrno-miR-370*
Sequence

13 - 

caggucacgucucugcaguuacac

 - 36

Get sequence
Deep sequencing2637 reads, 154 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-370-3p

Accession MIMAT0003122
Previous IDsrno-miR-370
Sequence

48 - 

gccugcugggguggaaccuggu

 - 69

Get sequence
Deep sequencing6091 reads, 240 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).