Stem-loop sequence rno-mir-483

AccessionMI0003485 (change log)
DescriptionRattus norvegicus miR-483 stem-loop
Gene family MIPF0000180; mir-483
Literature search

12 open access papers mention rno-mir-483
(185 sentences)

Stem-loop
          -          aa   aa   a u   uuu 
5' gaggggg aagacgggag  gag  ggg g ggu   u
   ||||||| ||||||||||  |||  ||| | |||    
3' cucucuu uucugcccuc  cuc  cuc c ccg   g
          g          cc   --   a u   ugg 
Get sequence
Deep sequencing
4901 reads, 0 reads per million, 263 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr1: 215832088-215832160 [-]
sense
ENSRNOT00000050760 ; Igf2-202; intron 2
ENSRNOT00000073850 ; Igf2-201; intron 2
Database links

Mature sequence rno-miR-483-5p

Accession MIMAT0017201
Previous IDsrno-miR-483*
Sequence

8 - 

aagacgggagaagagaagggag

 - 29

Get sequence
Deep sequencing1140 reads, 170 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence rno-miR-483-3p

Accession MIMAT0003121
Previous IDsrno-miR-483
Sequence

46 - 

cacuccuccccucccgucuugu

 - 67

Get sequence
Deep sequencing3760 reads, 235 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).