Stem-loop sequence rno-mir-215

AccessionMI0003482 (change log)
DescriptionRattus norvegicus miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

10 open access papers mention rno-mir-215
(29 sentences)

Stem-loop
   --------------  ug       c a  a     -  uu         gugug  u 
5'               gg  uacagga a ug ccuau ga  ugacagaca     gc c
                 ||  ||||||| | || ||||| ||  |||||||||     || n
3'               cu  augucuu u ac ggaug cu  acugucugu     cg n
   aacauuccuccucu  gu       a a  c     u  -u         --gug  u 
Get sequence
Deep sequencing
37521259 reads, 3.64e+04 reads per million, 506 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence rno-miR-215

Accession MIMAT0003118
Sequence

14 - 

augaccuaugauuugacagaca

 - 35

Get sequence
Deep sequencing37338703 reads, 506 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).