Stem-loop sequence rno-mir-361

AccessionMI0003481 (change log)
DescriptionRattus norvegicus miR-361 stem-loop
Gene family MIPF0000172; mir-361
Literature search

8 open access papers mention rno-mir-361
(13 sentences)

Stem-loop
        uu         --u  a    u    a  a 
5' gaagc  aucagaauc   cc gggg acuu uu u
   |||||  |||||||||   || |||| |||| ||  
3' cuuug  uagucuuag   gg cccc ugaa ag u
        cu         ugu  a    c    a  u 
Get sequence
Deep sequencing
132976 reads, 30.1 reads per million, 492 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chrX: 84708911-84708980 [-]
sense
ENSRNOT00000000174 ; Chm-201; intron 9
Database links

Mature sequence rno-miR-361-5p

Accession MIMAT0003117
Previous IDsrno-miR-361
Sequence

6 - 

uuaucagaaucuccagggguac

 - 27

Get sequence
Deep sequencing74056 reads, 490 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-361-3p

Accession MIMAT0017199
Previous IDsrno-miR-361*
Sequence

44 - 

cccccaggugugauucugauucgu

 - 67

Get sequence
Deep sequencing58920 reads, 490 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).