Stem-loop sequence rno-mir-383

AccessionMI0003478 (change log)
DescriptionRattus norvegicus miR-383 stem-loop
Gene family MIPF0000137; mir-383
Literature search

16 open access papers mention rno-mir-383
(45 sentences)

Stem-loop
   ----uccuca      aa    a        uug   gga 
5'           gaucag  ggug cuguggcu   ggu   u
             ||||||  |||| ||||||||   |||    
3'           cugguc  ucac gacaccga   cua   a
   acgagaaaga      cg    -        ---   auu 
Get sequence
Deep sequencing
66295 reads, 57.1 reads per million, 312 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Rnor_6.0; GCA_000001895.4) Overlapping transcripts
chr16: 57519675-57519748 [+]
intergenic
Database links

Mature sequence rno-miR-383-5p

Accession MIMAT0003114
Previous IDsrno-miR-383
Sequence

5 - 

cagaucagaaggugacugugg

 - 25

Get sequence
Deep sequencing65697 reads, 310 experiments
Evidence experimental; SOLiD [2]
Predicted targets

Mature sequence rno-miR-383-3p

Accession MIMAT0017197
Previous IDsrno-miR-383*
Sequence

47 - 

ccacagcacugccuggucaga

 - 67

Get sequence
Deep sequencing597 reads, 93 experiments
Evidence experimental; SOLiD [2]
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).