Stem-loop sequence mmu-mir-489

AccessionMI0003476 (change log)
Symbol MGI:Mir489
DescriptionMus musculus miR-489 stem-loop
Gene family MIPF0000111; mir-489
Literature search

24 open access papers mention mmu-mir-489
(292 sentences)

Stem-loop
   ----ac  c g  -       c                  a  a  cu    aaag 
5'       ug u ca guggcag uugguugucauaugugug ug ca  uucu    u
         || | || ||||||| |||||||||||||||||| || ||  ||||     
3'       ac a gu cauuguc aaucgacgguauauacac ac gu  aaga    c
   ugaaca  a g  a       a                  c  a  --    ccuu 
Get sequence
Deep sequencing
156 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr6: 3721897-3722003 [-]
sense
OTTMUST00000091195 ; Calcr-004; intron 1
OTTMUST00000091196 ; Calcr-003; intron 4
OTTMUST00000091182 ; Calcr-005; intron 4
OTTMUST00000091197 ; Calcr-001; intron 4
ENSMUST00000171396 ; Calcr-004; intron 1
ENSMUST00000170266 ; Calcr-202; intron 2
ENSMUST00000168592 ; Calcr-201; intron 2
ENSMUST00000171613 ; Calcr-003; intron 4
ENSMUST00000115622 ; Calcr-005; intron 4
ENSMUST00000075644 ; Calcr-001; intron 4
Clustered miRNAs
< 10kb from mmu-mir-489
mmu-mir-489chr6: 3721897-3722003 [-]
mmu-mir-653chr6: 3721301-3721385 [-]
Database links

Mature sequence mmu-miR-489-5p

Accession MIMAT0022704
Sequence

23 - 

ugucauaugugugaugacacuuucu

 - 47

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence not experimental
Predicted targets

Mature sequence mmu-miR-489-3p

Accession MIMAT0003112
Previous IDsmmu-miR-489
Sequence

60 - 

aaugacaccacauauauggcagc

 - 82

Get sequence
Deep sequencing151 reads, 19 experiments
Evidence experimental; cloned [2], Illumina [3-4]
Database links
Predicted targets

References

1
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:20215419 "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing" Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A Mol Hum Reprod. 16:463-471(2010).
4
PMID:20413612 "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes" Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP Genes Dev. 24:992-1009(2010).