Stem-loop sequence tni-mir-16

AccessionMI0003472 (change log)
DescriptionTetraodon nigroviridis miR-16 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --------          -ua          u  ag  u 
5'         uagcagcacg   aauauuggag ua  gc c
           ||||||||||   |||||||||| ||  || u
3'         gucgucgugc   uuaugaccuc au  ug c
   gaaacgaa          uag          c  ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
2: 11019481-11019552 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-16
tni-mir-15a2: 11019282-11019352 [+]
tni-mir-162: 11019481-11019552 [+]
Database links

Mature sequence tni-miR-16

Accession MIMAT0003108
Sequence

1 - 

uagcagcacguaaauauuggag

 - 22

Get sequence
Evidence by similarity; MI0001895