Stem-loop sequence fru-mir-16

AccessionMI0003471 (change log)
DescriptionFugu rubripes miR-16 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   gc  -  g    g          -ua          u  ag  u 
5'   ca cu ugcu uagcagcacg   aauauuggag ua  gc c
     || || |||| ||||||||||   |||||||||| ||  || u
3'   gu ga acga gucgucgugc   uuaugaccuc au  ug c
   ca  a  a    a          uag          c  ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602535.1: 12503814-12503902 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-16
fru-mir-15aHE602535.1: 12503660-12503730 [+]
fru-mir-16HE602535.1: 12503814-12503902 [+]
Database links

Mature sequence fru-miR-16

Accession MIMAT0003107
Sequence

13 - 

uagcagcacguaaauauuggag

 - 34

Get sequence
Evidence by similarity; MI0001895