Stem-loop sequence fru-mir-15a

AccessionMI0003469 (change log)
DescriptionFugu rubripes miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   cuggugaugcu ua         a          gg  a 
5'            g  gcagcacgg augguuugug  uu c
              |  ||||||||| ||||||||||  || a
3'            c  cgucguguc uaccggacau  ag c
   ----------a gc         a          ag  u 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602535.1: 12503660-12503730 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-15a
fru-mir-15aHE602535.1: 12503660-12503730 [+]
fru-mir-16HE602535.1: 12503814-12503902 [+]
Database links

Mature sequence fru-miR-15a

Accession MIMAT0003105
Sequence

13 - 

uagcagcacggaaugguuugug

 - 34

Get sequence
Evidence by similarity; MI0001892