Stem-loop sequence fru-let-7g

Accession MI0003461
Description Fugu rubripes let-7g stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u    u   gu     u          ----uua     ac 
 ggga gag  aguag uuguauaguu       ggauc  a
 |||| |||  ||||| ||||||||||       |||||   
 cccu uuc  ucauc gacauaucaa       ucuag  c
a    -   ug     u          uagaggg     ac 
Get sequence
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5) Overlapping transcripts
HE602537.1: 6725744-6725822 [+]
intergenic
Clustered miRNAs
< 10kb from fru-let-7g
fru-let-7g HE602537.1: 6725744-6725822 [+]
fru-let-7h HE602537.1: 6726015-6726098 [+]

Mature sequence fru-let-7g

Accession MIMAT0003097
Sequence

6 - 

ugagguaguaguuuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001874