Stem-loop sequence tni-mir-210

AccessionMI0003460 (change log)
DescriptionTetraodon nigroviridis miR-210 stem-loop
Gene family MIPF0000086; mir-210
Stem-loop
   ----------     g    a   acua       u  -u  cag 
5'           caggu agcc cug    acgcaca ug  gc   u
             ||||| |||| |||    ||||||| ||  ||   u
3'           gucca ucgg gac    ugcgugu ac  ug   g
   agggguuuug     a    c   agug       c  cu  aca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
13: 6095025-6095106 [+]
intergenic
Database links

Mature sequence tni-miR-210

Accession MIMAT0003096
Sequence

47 - 

cugugcgugugacagcggcuaa

 - 68

Get sequence
Evidence by similarity; MI0001379