Stem-loop sequence tni-mir-96

AccessionMI0003456 (change log)
DescriptionTetraodon nigroviridis miR-96 stem-loop
Gene family MIPF0000072; mir-96
Stem-loop
   uug  c  u         g     uu      -cu   u 
5'    cc au uuggcacua cacau  uugcuu   gua a
      || || ||||||||| |||||  ||||||   |||  
3'    gg ua aaccgugau gugua  aacgag   cau u
   aga  a  u         -     uu      uuu   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
19: 3385386-3385463 [-]
intergenic
Clustered miRNAs
< 10kb from tni-mir-96
tni-mir-18319: 3385637-3385706 [-]
tni-mir-9619: 3385386-3385463 [-]
tni-mir-18219: 3385158-3385224 [-]
Database links

Mature sequence tni-miR-96

Accession MIMAT0003092
Sequence

9 - 

uuuggcacuagcacauuuuugcu

 - 31

Get sequence
Evidence by similarity; MI0001955