Stem-loop sequence tni-mir-9-3

AccessionMI0003452 (change log)
DescriptionTetraodon nigroviridis miR-9-3 stem-loop
Gene family MIPF0000014; mir-9
Stem-loop
   ggagcugu       uc               g     ---      
5'         guuucug  uuugguuaucuagcu uauga   guguu 
           |||||||  ||||||||||||||| |||||   |||| a
3'         uaaagau  aagccaauagaucga auacu   cauaa 
   --------       ga               a     guc      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
13: 5474095-5474176 [+]
intergenic
Database links

Mature sequence tni-miR-9

Accession MIMAT0002911
Sequence

16 - 

ucuuugguuaucuagcuguauga

 - 38

Get sequence
Evidence by similarity; MI0001883