Stem-loop sequence tni-mir-15b

AccessionMI0003448 (change log)
DescriptionTetraodon nigroviridis miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   gc       cug  uu       c  c          augaug g 
5'   ccuuaga   cu  agcagcg au augguuugua      u g
     |||||||   ||  ||||||| || ||||||||||      |  
3'   ggaauuu   ga  ucgucgu ua uaccaaacgu      a a
   aa       uaa  uu       u  a          -ggaaa a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
16: 2089810-2089900 [-]
sense
ENSTNIT00000010705 ; smc4-201; intron 5
ENSTNIT00000000043 ; smc4-202; intron 5
Database links

Mature sequence tni-miR-15b

Accession MIMAT0003086
Sequence

16 - 

uagcagcgcaucaugguuugua

 - 37

Get sequence
Evidence by similarity; MI0001893