Stem-loop sequence tni-mir-20

AccessionMI0003444 (change log)
DescriptionTetraodon nigroviridis miR-20 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   - c       -           g     g   uuu  u 
5'  g aguauua aagugcuuaua ugcag uag   uc c
    | ||||||| ||||||||||| ||||| |||   ||  
3'  c ucaugau uucacgaguau acguc auc   gg a
   u u       c           g     -   --u  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
2: 12892487-12892559 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-20
tni-mir-17-22: 12891968-12892049 [+]
tni-mir-202: 12892487-12892559 [+]
tni-mir-92-12: 12892714-12892787 [+]
Database links

Mature sequence tni-miR-20

Accession MIMAT0003084
Sequence

8 - 

uaaagugcuuauagugcagguag

 - 30

Get sequence
Evidence by similarity; MI0001907