Stem-loop sequence fru-mir-20

AccessionMI0003443 (change log)
DescriptionFugu rubripes miR-20 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -------  c       -           g     g   uua u 
5'        ag aguauua aagugcuuaua ugcag uag   c g
          || ||||||| ||||||||||| ||||| |||   |  
3'        uc ucaugau uucacgagugu acguc auc   g a
   acguaga  u       c           g     -   -ug u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602535.1: 14441541-14441620 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-20
fru-mir-17-2HE602535.1: 14441014-14441095 [+]
fru-mir-20HE602535.1: 14441541-14441620 [+]
fru-mir-92-1HE602535.1: 14441769-14441847 [+]
Database links

Mature sequence fru-miR-20

Accession MIMAT0003083
Sequence

9 - 

uaaagugcuuauagugcagguag

 - 31

Get sequence
Evidence by similarity; MI0001907