Stem-loop sequence tni-mir-17-2

Accession MI0003442
Description Tetraodon nigroviridis miR-17-2 stem-loop
Gene family MIPF0000001; mir-17
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-17_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-17 microRNA precursor family are a group of related small non-coding RNA genes called microRNAs that regulate gene expression. The microRNA precursor miR-17 family, includes miR-20, miR-91, and miR-103. miRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 3' arm of the precursor. The products are thought to have regulatory roles through complementarity to the 3' UTR of mRNA. A screen of 17 miRNAs that have been predicted to regulate a number of breast cancer associated genes found variations in the microRNAs miR-17 and miR-30c-1, these patients were noncarriers of BRCA1 or BRCA2 mutations, lending the possibility that familial breast cancer may be caused by variation in these miRNAs.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
g   cc       -c         a  g     g   uuaa 
 uca  guagugu  aaagugcuu ca ugcag uag    a
 |||  |||||||  ||||||||| || ||||| |||    a
 agu  uaucacg  uuucacgga gu acguc auc    g
-   cu       ac         a  g     -   uaaa 
Get sequence
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
2: 12891968-12892049 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-17-2
tni-mir-17-2 2: 12891968-12892049 [+]
tni-mir-20 2: 12892487-12892559 [+]
tni-mir-92-1 2: 12892714-12892787 [+]

Mature sequence tni-miR-17

Accession MIMAT0002917
Sequence

14 - 

caaagugcuuacagugcaggua

 - 35

Get sequence
Evidence by similarity; MI0001897