Stem-loop sequence fru-mir-17-2

AccessionMI0003441 (change log)
DescriptionFugu rubripes miR-17-2 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   g   a        -c         a  g     g   uu  a 
5'  uca aguagugu  aaagugcuu ca ugcag uag  ug u
    ||| ||||||||  ||||||||| || ||||| |||  ||  
3'  agu uuaucgcg  uuucacgga gu acguc auc  ac g
   -   c        ac         a  g     -   -u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602535.1: 14441014-14441095 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-17-2
fru-mir-17-2HE602535.1: 14441014-14441095 [+]
fru-mir-20HE602535.1: 14441541-14441620 [+]
fru-mir-92-1HE602535.1: 14441769-14441847 [+]
Database links

Mature sequence fru-miR-17

Accession MIMAT0002916
Sequence

14 - 

caaagugcuuacagugcaggua

 - 35

Get sequence
Evidence by similarity; MI0001898