Stem-loop sequence fru-let-7a-1

Accession MI0003407
Description Fugu rubripes let-7a-1 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
c   uu   g   u             ---gaga   a 
 agg  gag uag agguuguauaguu       gug c
 |||  ||| ||| |||||||||||||       |||  
 ucc  uuc auc uccgacaugucag       cac a
-   cu   g   c             uagagga   c 
Get sequence
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5) Overlapping transcripts
HE602549.1: 9611356-9611429 [+]
intergenic
Clustered miRNAs
< 10kb from fru-let-7a-1
fru-mir-100 HE602549.1: 9610912-9610974 [+]
fru-let-7a-1 HE602549.1: 9611356-9611429 [+]
fru-mir-125b HE602549.1: 9617257-9617326 [+]

Mature sequence fru-let-7a

Accession MIMAT0002928
Sequence

6 - 

ugagguaguagguuguauaguu

 - 27

Get sequence
Evidence by similarity; MI0001863