Stem-loop sequence fru-mir-29a-2

Accession MI0003403
Description Fugu rubripes miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-29_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-29 microRNA precursor, or pre-miRNA, is a small RNA molecule in the shape of a stem-loop or hairpin. Each arm of the hairpin can be processed into one member of a closely related family of short non-coding RNAs that are involved in regulating gene expression. The processed, or "mature" products of the precursor molecule are known as microRNA (miRNA), and have been predicted or confirmed in a wide range of species (see 'MIPF0000009' in miRBase: the microRNA database).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
gaagacagucuuggacucccuucccc   -c     caaaag            uuc       g    uc   u 
                          guc  uccac      augacugauuuc   uggugcu agag  ggc g
                          |||  |||||      ||||||||||||   ||||||| ||||  |||  
                          uag  gggug      uauuggcuaaag   accacga ucuu  ccg c
----------------------uaca   cu     acaaaa            uuu       -    --   a 
Get sequence
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Mature sequence fru-miR-29a

Accession MIMAT0003053
Sequence

84 - 

uagcaccauuugaaaucgguua

 - 105

Get sequence
Evidence by similarity; MI0001938