Stem-loop sequence fru-mir-29a-2

AccessionMI0003403 (change log)
DescriptionFugu rubripes miR-29a-2 stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   gaagacagucuuggacucccuucccc   -c     caaaag            uuc       g    uc   u 
5'                           guc  uccac      augacugauuuc   uggugcu agag  ggc g
                             |||  |||||      ||||||||||||   ||||||| ||||  |||  
3'                           uag  gggug      uauuggcuaaag   accacga ucuu  ccg c
   ----------------------uaca   cu     acaaaa            uuu       -    --   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE591818.1: 89490-89615 [-]
intergenic
Clustered miRNAs
< 10kb from fru-mir-29a-2
fru-mir-29b-1HE591818.1: 89646-89722 [-]
fru-mir-29a-2HE591818.1: 89490-89615 [-]
Database links

Mature sequence fru-miR-29a

Accession MIMAT0003053
Sequence

84 - 

uagcaccauuugaaaucgguua

 - 105

Get sequence
Evidence by similarity; MI0001938