Stem-loop sequence tni-mir-29b-2

AccessionMI0003396 (change log)
DescriptionTetraodon nigroviridis miR-29b-2 stem-loop
Gene family MIPF0000009; mir-29
Literature search

1 open access papers mention tni-mir-29b-2
(3 sentences)

Stem-loop
   -   uu   a                 g  u   guauu 
5'  cuc  gga gcugguuucagguggug cu aga     g
    |||  ||| ||||||||||||||||| || |||     u
3'  ggg  cuu ugacuaaaguuuaccac ga ucu     c
   g   uu   g                 -  -   aucua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
9: 9583198-9583275 [+]
intergenic
Clustered miRNAs
< 10kb from tni-mir-29b-2
tni-mir-29b-29: 9583198-9583275 [+]
tni-mir-29a-19: 9583403-9583474 [+]
Database links

Mature sequence tni-miR-29b

Accession MIMAT0003056
Sequence

49 - 

uagcaccauuugaaaucagugu

 - 70

Get sequence
Evidence by similarity; MI0001936