Stem-loop sequence dre-mir-181a-2

AccessionMI0003387 (change log)
Previous IDsdre-mir-181a
DescriptionDanio rerio miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

18 open access papers mention dre-mir-181a-2
(68 sentences)

Stem-loop
   ------uugguga   u      cu       a    --    c 
5'              aca ucaacg  gucggug guuu  ugcg u
                ||| ||||||  ||||||| ||||  ||||  
3'              ugu aguugc  cagcuac caaa  augu u
   ggugggaguccca   c      --       -    ca    c 
Get sequence
Deep sequencing
941330 reads, 6.02e+04 reads per million, 11 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 53023539-53023617 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-181a-2
dre-mir-181a-2chr8: 53023539-53023617 [+]
dre-mir-181b-2chr8: 53023679-53023764 [+]
Database links

Mature sequence dre-miR-181a-5p

Accession MIMAT0001623
Previous IDsdre-miR-181a
Sequence

7 - 

aacauucaacgcugucggugagu

 - 29

Get sequence
Deep sequencing4592586 reads, 11 experiments
Evidence by similarity; MI0001380

Mature sequence dre-miR-181a-2-3p

Accession MIMAT0032007
Sequence

48 - 

accaucgaccguugacuguacc

 - 69

Get sequence
Deep sequencing22744 reads, 11 experiments
Evidence not experimental
Database links