Stem-loop sequence dre-mir-212

AccessionMI0003385 (change log)
DescriptionDanio rerio miR-212 stem-loop
Gene family MIPF0000065; mir-132
Literature search

5 open access papers mention dre-mir-212
(57 sentences)

Stem-loop
        u  a   a  -  u     c       c      c  aa gug 
5' gucag gc uca ua cc uggcu uagacug uuacug ua  u   u
   ||||| || ||| || || ||||| ||||||| |||||| ||  |    
3' cgguc ug agu au gg acuga aucugac aaugac au  a   c
        -  c   c  c  u     c       -      -  ga agu 
Get sequence
Deep sequencing
278 reads, 0 reads per million, 10 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was predicted by computational methods using conservation between human, mouse and Fugu rubripes sequences [1]. Expression of the excised miR was validated in zebrafish, and the 5' end mapped by PCR. The 3' end was not experimentally determined.

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr15: 25897446-25897539 [+]
intergenic
Clustered miRNAs
< 10kb from dre-mir-212
dre-mir-212chr15: 25897446-25897539 [+]
dre-mir-132-1chr15: 25897715-25897799 [+]
Database links

Mature sequence dre-miR-212

Accession MIMAT0003049
Sequence

61 - 

uaacagucuacagucauggcu

 - 81

Get sequence
Deep sequencing37 reads, 10 experiments
Evidence experimental; PCR [1]
Predicted targets

References

1
PMID:12624257 "Vertebrate microRNA genes" Lim LP, Glasner ME, Yekta S, Burge CB, Bartel DP Science. 299:1540(2003).