Stem-loop sequence tni-mir-26

AccessionMI0003370 (change log)
DescriptionTetraodon nigroviridis miR-26 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
     guua    u gg     uu         c           -  ua 
5' gc    ggcc c  ccugg  caaguaauc aggauaggcug gu  a
   ||    |||| |  |||||  ||||||||| ||||||||||| ||  c
3' cg    ccgg g  ggacu  guucauuag ucuuauccggc cg  c
     accg    u aa     gu         u           a  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
Un_random: 52438968-52439063 [+]
antisense
Un_random: 75864781-75864876 [-]
antisense
Database links

Mature sequence tni-miR-26

Accession MIMAT0003038
Sequence

20 - 

uucaaguaauccaggauaggcu

 - 41

Get sequence
Evidence by similarity; MI0001927