Stem-loop sequence fru-mir-196b

AccessionMI0003365 (change log)
DescriptionFugu rubripes miR-196b stem-loop
Gene family MIPF0000031; mir-196
Stem-loop
   ugugaua            a   g   ggcuga  u 
5'        uagguaguuuca guu uug      ac c
          |||||||||||| ||| |||      ||  
3'        guccgucaaagu caa gac      ug u
   ----uga            c   g   -acuag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE602539.1: 523031-523099 [+]
intergenic
Database links

Mature sequence fru-miR-196b

Accession MIMAT0003033
Sequence

8 - 

uagguaguuucaaguuguuggg

 - 29

Get sequence
Evidence by similarity; MI0002036