Stem-loop sequence dre-mir-135b

AccessionMI0003364 (change log)
DescriptionDanio rerio miR-135b stem-loop
Gene family MIPF0000028; mir-135
Literature search

6 open access papers mention dre-mir-135b
(15 sentences)

Stem-loop
       uu    c           u        c    aa  g 
5' cucu  gccc guauggcuuuu auuccuau ugag  uu c
   ||||  |||| ||||||||||| |||||||| ||||  ||  
3' gggg  cggg cguaccgaagg uagggaua acuc  ga u
       -u    a           -        u    ag  c 
Get sequence
Deep sequencing
1710 reads, 44.4 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This zebrafish miRNA sequence is predicted based on homology with a verified mammalian sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (GRCz11; GCA_000002035.4) Overlapping transcripts
chr8: 26005588-26005669 [+]
intergenic
Database links

Mature sequence dre-miR-135b-5p

Accession MIMAT0003032
Previous IDsdre-miR-135b
Sequence

13 - 

uauggcuuuuuauuccuaucug

 - 34

Get sequence
Deep sequencing279 reads, 7 experiments
Evidence by similarity; MI0001996
Database links
Predicted targets

Mature sequence dre-miR-135b-3p

Accession MIMAT0032006
Sequence

52 - 

auauagggauggaagccaugca

 - 73

Get sequence
Deep sequencing1375 reads, 6 experiments
Evidence not experimental
Database links