Stem-loop sequence tni-mir-455

AccessionMI0003361 (change log)
DescriptionTetraodon nigroviridis miR-455 stem-loop
Gene family MIPF0000129; mir-455
Stem-loop
     c   u ug   -          u      a   c   gaa 
5' cc uga g  agg guaugugccc uggacu cau gug   g
   || ||| |  ||| |||||||||| |||||| ||| |||    
3' gg acu c  uuc cauauacggg accuga gua cac   c
     a   - cu   a          u      c   c   gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Tetraodon8) Overlapping transcripts
12: 4822210-4822293 [-]
sense
ENSTNIT00000018896 ; col27a1b-201; intron 12
Database links

Mature sequence tni-miR-455

Accession MIMAT0003029
Sequence

15 - 

uaugugcccuuggacuacaucg

 - 36

Get sequence
Evidence by similarity; MI0003513