Stem-loop sequence fru-mir-199-1

Accession MI0003358
Description Fugu rubripes miR-199-1 stem-loop
Gene family MIPF0000040; mir-199
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-199_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-199 microRNA precursor (homologous to miR-215), is a short non-coding RNA gene involved in gene regulation. miR-192 and miR-215 have now been predicted or experimentally confirmed in mouse, human and a further 21 other species. (MIPF0000040). microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. The mature products are thought to have regulatory roles through complementarity to mRNA.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
u  -   u c   auc       u        c   ---    ga 
 cc ugc c guc   ccagugu cagacuac ugu   ucag  u
 || ||| | |||   ||||||| |||||||| |||   ||||  u
 gg acg g cag   gguuaca gucugaug aca   gguc  u
-  u   u a   auu       c        -   ugu    au 
Get sequence
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5) Overlapping transcripts
HE602554.1: 3508828-3508914 [+]
intergenic
Clustered miRNAs
< 10kb from fru-mir-199-1
fru-mir-199-1 HE602554.1: 3508828-3508914 [+]
fru-mir-214 HE602554.1: 3510928-3511026 [+]

Mature sequence fru-miR-199

Accession MIMAT0002959
Sequence

15 - 

cccaguguucagacuaccuguuc

 - 37

Get sequence
Evidence by similarity; MI0001373