Stem-loop sequence tni-mir-144

AccessionMI0003349 (change log)
DescriptionTetraodon nigroviridis miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
   c      c  g         u        -a   uaa 
5'  ccugga ag auaucaucu auacugua  guu   u
    |||||| || ||||||||| ||||||||  |||   a
3'  ggaccu uc uguaguaga uaugacau  cag   a
   -      a  a         -        ca   uga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Tetraodon miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (Tetraodon8) Overlapping transcripts
7: 2925538-2925611 [-]
intergenic
Database links

Mature sequence tni-miR-144

Accession MIMAT0003021
Sequence

48 - 

uacaguauagaugauguacu

 - 67

Get sequence
Evidence by similarity; MI0002009