Stem-loop sequence fru-mir-144

AccessionMI0003348 (change log)
DescriptionFugu rubripes miR-144 stem-loop
Gene family MIPF0000093; mir-144
Stem-loop
         c  g          a       -a    au 
5' ccugga ag auaucaucua uacugua  guuu  u
   |||||| || |||||||||| |||||||  ||||  a
3' ggaccu uc uguaguagau augacau  caga  a
         a  a          -       ca    ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This Fugu miRNA sequence is predicted based on homology with a verified zebrafish sequence (Mihaela Zavolan, personal communication).

Genome context
Coordinates (FUGU5; GCA_000180615.2) Overlapping transcripts
HE591942.1: 35509-35581 [+]
intergenic
Database links

Mature sequence fru-miR-144

Accession MIMAT0003020
Sequence

47 - 

uacaguauagaugauguacu

 - 66

Get sequence
Evidence by similarity; MI0002009